Piltdown Hoax

1. Begin by giving a brief synopsis of the Piltdown hoax, including when and where it was found, by whom, and varying affects this had on the scientific community. Also include how the hoax was discovered and the varying responses it received from the scientist(s) involved and in the related fields of human evolution. (5 pts)

The Piltdown Man was a hoax in which fragments of bone were discovered by a group of well-respected scientists, including Charles Dawson, Arthur Smith Woodward, and Tielhard de Chardin. These bones were classified as fossilized remains of an unknown early human. The expeditions where they discovered the fragments were located in Piltdown, a community in Southeast England. The significance of this paleontological find was highly controversial until the expedition was exposed as a hoax. This piece of evidence was believed to be the missing link between humans and apes, but that couldn’t be farther from the truth. This is because the lower jawbone found in the dig was later proven to be an orangutan jawbone as opposed to that of a human. Also, radioactive dating evolved in the 20^th century, which helped in proving this discovery was a full-blown hoax. The scientific community was duped and has since learned from their experiences.

2. Scientists are curious, creative and persistent by nature, but being human, they also have faults. What human faults come into play here in this scenario and how did these faults negatively impact the scientific process? (5 pts)

The human faults that play a role in this case include pride, deceit, greed, fraud, and competition. Other reason that the hoax was not pointed out sooner was that scientists weren’t allowed to examine the evidence in addition to not questioning the credibility of other scientists during the time period. All of these traits prevented the hoax from being exposed much sooner than it should have. However, we are all human and we have learned from these mistakes since then.

3. What positive aspects of the scientific process were responsible for revealing the skull to be a fraud? Be specific about scientific tools, processes or methodologies that were involved in providing accurate information about the Piltdown skull. (5 pts)

The positive aspects that led scientists to expose this fraud were the advances in radiometric dating that occurred throughout the 20^th century. A paleontologist, known as Kenneth Oakley, created a revolutionary new way to more accurately date fossils. This technique was known as fluorine testing. To prove the remains found in the dig were authentic, Oakley was brought in to test them because he had no prior involvement in the excavation. The remains contained similar amount of fluorine to one another, but overall, the findings suggested that the bones were much younger than previously presumed. In 1953, an improved fluorine test was implemented and the jawbone was dated back to less than 100 years ago. They were just old bones and were not eve fossils. The remains were also proven to be stained and filed down to match the appearance of human remains rather than orangutan remains, which they were.

4. Is it possible to remove the “human” factor from science to reduce the chance of errors like this happening again? Would you want to remove the human factor from science? (10 pts)

In this case, it is very much possible to remove the negative human factors, including deceit, fraud, and greed. These negative human factors can never be beneficial to the scientific community or the scientific method. However, not all humans are blatantly malicious like in this case. Humans bring a healthy curiosity and a fervor to understand new concepts that is unlike any other. Humans cannot be fully replaced in science, but qualities that hinder the scientific method can most certainly be thrown out.

5. Life Lesson: What lesson can you take from this historical event regarding taking information at face value from unverified sources? (5 pts)

I have learned now that taking something at face value is never a good choice. Without evidence to back of certain information, the information is practically useless. Also, I have learned to never falsify information for selfish gains. Because of this hoax, scientists will learn from their previous mistakes and look at the credibility of the evidence as well as the finder.

Analogy and Homology

1. For your homologus traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the homologus trait. (5 pts)

Humans are unique because of their a larger and more developed brain as well as their unique bipedal locomotion that is most commonly seen in humans. Bats are one of the few mammals that is able to fly. They are also nocturnal and their bones are hollow just like other birds in the world. This weight difference allows this species to bee able to fly.

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)

A bat has a greater flexible tendency as opposed to birds’ bone structures. It has many similarities to the human forearm, with the exception of its thin membrane of skin located between each finger bone. A bats wing can move just like a human hand. The bat is essentially swimming in air. Another difference between the two “hands” is the thumb sticks out of the bat’s wing as a small claw. This aids bats in climbing and suspending themselves from different structures.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait? (5 pts)

Since the bones structure and purpose of the traits are comparable with humans and bats, the traits must have come from a common ancestor. The common ancestor between bats and humans must have been a land mammal that similar bone structure within its forearm. It is believed this ancestor came into being just under 100 million years ago.

d. Provide an image of each species in this comparison. (5 pts)

2. For your analogous traits provide the following information (25 pts):

a. Briefly describe the two different species that possess the analogous trait. (5 pts)

Butterflies are unique because they are one of the few insects that migrate to different geographic locations with the changing seasons. However, they are one of the many insects that have the ability to fly. Most insects have the same structure in wings. They also go through metamorphosis where they change from a caterpillar to a butterfly. Eagles have very similar bone structure to the human forearm, but their wings have evolved to allow them to survive and be considered the predators in the air. Their bones are hollow in addition to many other species of birds.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)

Both eagles and butterflies have wings. The similarity between the two is that both organisms have adapted to life in the air and because of that, their wings have evolved. However, both types of wings have evolved independently of one another. This means that they are not closely related, so “the possession of wings” is an analogous trait.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not? (5 pts)

The common ancestor did not have this analogous trait, because eagle wings developed from the evolution of the forearm. The change in forearm structure for birds came much later than the separation between insects and other species. Since the wings developed at two different time periods, a common ancestor could not have possessed the analogous trait.

d. Provide an image of each species in this comparison. (5 pts)

Protein Synthesis Blog Post

ACCGTACCAAGGGAACGGTAGTGGCTTGACACAAGTCTGAATCTCCA

Historical Influences on Darwin

1. Select one of the five individuals listed above who you would argue had the most influence over Darwin’s development of his theory of Natural selection. This could be a positive or a negative influence.

Alfred Russel Wallace was so influential over Darwin that many considered him the first to discover the theory of evolution through natural selection. His finding and observations through his many explorations led Darwin to make the connections to formulate the theory in a coherent fashion. Wallace sent Darwin skins of birds from his research opportunities in the Far East. Wallace published these findings in a paper entitled, “On the Law which has Regulated the Introduction of New Species.” Darwin got a chance to review the findings, but he was not as impressed, believing it to be a bit vague as to the specifics of the theory. In 1858, Wallace authored another report entitled, “On the Tendency of Varieties to Depart Indefinitely from the Original Type” and sent a copy of it to Darwin for personal use as well as for reviewing his work. He disagreed with Wallace's idea of natural selection stated as the “environmental weeding out” process of those weaker species that could not adapt, whereas Darwin said that “competition” referred to that process. Wallace also believed the mutation observed satisfied a goal, which is the construction of the perfect man.


2. Briefly (but completely) describe the contribution this individual made to the scientific community. You must provide one link to an online source of information besides your textbook. No Wikipedia sources! (10 pts)

Wallace is probably best known for formulating his unique “theory of evolution,” which was very similar to Darwin's due to the continued back and forth between the two. During 1848, he began an exploration throughout the Amazon. He began traveled back to England four years later, but during his trek back home, his vessel caught fire and his collection of specimen fell victim to the disaster. Thankfully, he was saved and used the following two years to write two books on his journey into South America. Wallace soon left on another research opportunity in the Far East in 1854. He used most of his time there studying specimen on the Malaysian islands, paying close attention to their inhabitation patterns and the comparing of similar species in Australia. When he was in Malay Archipelago, he began to question how these differences were brought about with his theory on “natural selection.” His books, “Malay Archipelago” and “Contributions to the Theory of Natural Selection,” allowed him to publish his findings from his exploration in the Far East.

Sources:

http://www.guardian.co.uk/science/2013/jan/20/alfred-russel-wallace-forgotten-man-evolution

3. From the bullet point list above (under “How does evolution work?”), identify the point (or points) most directly affected by this individual’s work and thoroughly explain how this point was influenced by your selected individual. Again, this could be a positive effect, meaning Darwin built upon the knowledge this information provided, or a negative effect, meaning that Darwin demonstrated that this individual’s idea(s) were incorrect and the mechanism of natural selection was an alternative explanation. (10 pts)

Although Wallace never formulated his findings into a cohesive theory, he did find a large amount of evidence to answer the question of who gets better access to these limited resources. Throughout his expeditions, he began to question why some organisms die while others of the same species live on. He soon realized that only the best fitted live, meaning the organisms best suited for the environment thrive. This led him to find different variations in animals and plants that gave them a particular advantage in their natural habitat. Darwin used many of his findings to support his own theories, but some information of Wallace’s was incorrect that Darwin clarified in his theories.

4. Could Darwin have developed his theory of natural selection without the influence and ideas of this individual? Explain. (10 pts)

           

I believe Darwin could have theorized natural selection without Wallace’s influence, but it would have taken many years of additional research to make up for Wallace’s findings. Wallace presented much of his findings to Darwin, which led him to contemplate why there were differences between similar species. However, even with the amount of data Wallace collected, he could not tie everything together in one absolute theory. Since Darwin was the one who made the connections and was in a higher social class than Wallace, he is given all the credit for the theory of natural selection. However without Wallace’s findings, the creation of this theory would have required more analysis and research on Darwin’s part.

5. How did the attitude of the church affect Darwin and his eventual publication of his book On the Origin of Species? (10 pts)

Darwin understood that the church would be in an uproar once they read his publication. The church believed any opposition to the idea of creation and the words set forth by the Holy Bible was sac religious. There was never any encouragement from the theological side for him to publish his book. However, scientists like Wallace pushed him to publish the book and let the world see his findings. For better or for worse.